View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4938_low_6 (Length: 251)
Name: NF4938_low_6
Description: NF4938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4938_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 5 - 241
Target Start/End: Original strand, 23425364 - 23425600
Alignment:
| Q |
5 |
tgtatagattaaactcatgcaaatgagaaaacacaaaaatagagtatggggtcattcactatttagtctagtgacatacacaattgcgactataatcatc |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
23425364 |
tgtatagattaaactcatgcaaatgagaaaacacaaaaatagagtatggggtcattcactatttagtctagtaacatacacaattgcgactataatcatc |
23425463 |
T |
 |
| Q |
105 |
caagagctgattattgaaagaagcacaaaagatgctagaatagagattcgatttggtcctcataatttaatagcatcccaaaataatcgttgnnnnnnnt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
23425464 |
caagagctgattattgaaagaagcacaaaagatgctagaacagagattcgatttggtcctcataatttaatagcatcccaaaataatcgttgaaaaaaat |
23425563 |
T |
 |
| Q |
205 |
atctaaattagtctctgacattttcatactagaataa |
241 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
23425564 |
atctaaattagtctctgatattttcatatcagaataa |
23425600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University