View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4939_high_5 (Length: 253)
Name: NF4939_high_5
Description: NF4939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4939_high_5 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 8e-76; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 102 - 253
Target Start/End: Complemental strand, 29528746 - 29528595
Alignment:
| Q |
102 |
aggaaattagaaatgtggtatttaccttgtccctcacaaatccttctcaagaaagctaggaaaataataagtatagctacagctgctaataatccaataa |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29528746 |
aggaaattagaaatgtggtatttaccttgtccctcacaaatccttctcaagaaagctaggaaaataatgagtatagctacagctgctaataatccaataa |
29528647 |
T |
|
| Q |
202 |
ttatggcaaatgtcttctcaccatcgtggtctgatttaactgcaagaccagt |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29528646 |
ttatggcaaatgtcttctcaccatcgtggtctgatttacctgcaagaccagt |
29528595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 15 - 43
Target Start/End: Complemental strand, 29530694 - 29530666
Alignment:
| Q |
15 |
aatattaaaacaaatatagaattatttag |
43 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29530694 |
aatattaaaacaaatatagaattatttag |
29530666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University