View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4939_low_12 (Length: 211)
Name: NF4939_low_12
Description: NF4939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4939_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 8e-51; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 90 - 195
Target Start/End: Original strand, 25995646 - 25995751
Alignment:
| Q |
90 |
ttaaattttgcaatgtatccttattgtattaaatgcttgaattctctaaacatagtaatgtaataaatgaacacatttctactccctgcctccttctctt |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25995646 |
ttaaattttgcaatgtatccttattgtattaaatgcttgaattctctaaacatagtaatgtaataaatgaacacattactactccctgcctccttctctt |
25995745 |
T |
|
| Q |
190 |
ttgcac |
195 |
Q |
| |
|
|||||| |
|
|
| T |
25995746 |
ttgcac |
25995751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 28 - 99
Target Start/End: Original strand, 25995389 - 25995460
Alignment:
| Q |
28 |
gtgattggtgatgactgcatttggaatcctgcacggtatgttatggcagtctagttggtgcattaaattttg |
99 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25995389 |
gtgattggtgatgtctgcatttggaatcctgcacggtatgttatggcagtctagttggtgcattaaattttg |
25995460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University