View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4939_low_4 (Length: 260)
Name: NF4939_low_4
Description: NF4939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4939_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 250
Target Start/End: Original strand, 54504921 - 54505173
Alignment:
| Q |
1 |
tcaactccaattcctcatcctcggaaacgttcaccagtttcaccatcaccatcac------tgtcaaagtcgccttcagtaccctcagagtcaccatcac |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
54504921 |
tcaactccaattcctcatcctcggaaacgttcaccagcttcaccatcaccatcaccatcactgtcaaagtcgccttca---ccctccgagtcaccatcac |
54505017 |
T |
|
| Q |
95 |
tggcaccgtcaccttcagattcagtagcttcattggccccgtcatcttcaccttcagacgagtcaccttcaccggcaccgtccccaagttcatctggtag |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54505018 |
tggcaccgtcaccttcagattcagtagcttcattggcaccgtcatcttcaccttcagacgagtcaccttcaccggcaccgtccccaagttcatctggtag |
54505117 |
T |
|
| Q |
195 |
taaaggtggtggtgctggccatggattcttggaagtttcaatcgctatgatgatgt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54505118 |
taaaggtggtggtgctggccatggattcttggaagtttcaatcgctatgatgatgt |
54505173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University