View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4939_low_6 (Length: 250)
Name: NF4939_low_6
Description: NF4939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4939_low_6 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 13 - 250
Target Start/End: Original strand, 34253180 - 34253406
Alignment:
| Q |
13 |
attcttgcaccaaatcttgattataggtttctccgttgtgtgctctgtgagattgtgatgtttcctcggctttttccctccactcccgacgatgaatttt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34253180 |
attcttgcaccaaatcttgattataggtttctccgttg-----------agattgtgatgtttcctcggctttttccctccactcccgacgatgaatttt |
34253268 |
T |
 |
| Q |
113 |
gtgattacataatatgtcgttttcttttgattgtaattatgctgtacatctgcgaagatggaaatatgaatatgaagttactgtgcgagattgtatatct |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34253269 |
gtgattacataatatgtcgttttcttttgattgtaattatgttgtacatctgcgaagatggaaatatgaatatgaagttactgtgcgagattgtatatct |
34253368 |
T |
 |
| Q |
213 |
gtaagggtttattttgaagacttgtgtgcatgctttat |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34253369 |
gtaagggtttattttgaagacttgtgtgcatgctttat |
34253406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University