View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4939_low_9 (Length: 237)
Name: NF4939_low_9
Description: NF4939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4939_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 166
Target Start/End: Original strand, 42591968 - 42592133
Alignment:
| Q |
1 |
aaaatatatatataaaaattgaacatccttaaagtatatgaaatcaatgaagttagtctctagtgtatattatattaacgttaaattgatgaattagaaa |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42591968 |
aaaatatatattaaaaaattgaacatccttaaagtatatgaaatcaatgaagttagtctctagtgtatattatattaacgttaaattgatgaattagaaa |
42592067 |
T |
|
| Q |
101 |
gacattgatggtactttaggaactaaaatttgataggtatttcaatgaaattgtgatgaggatcca |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
42592068 |
gacattgatggtactttaggaactaaaatttgatggttatttcaatgaaattgtgatgaggatcca |
42592133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University