View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4940_low_8 (Length: 240)
Name: NF4940_low_8
Description: NF4940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4940_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 107 - 221
Target Start/End: Original strand, 7459752 - 7459866
Alignment:
| Q |
107 |
acctaaatacgggagcaatttagtgtttactagtatagttataacattttaaagttataaaatagtgtgtgtgagatcggtataaacatttaaatgatac |
206 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
7459752 |
acctaaatacgggagaaatttagtgtttactagtatagttataacattttaaagttataaaatagtgtgtgtgagatcggtataaacatctaaatgatac |
7459851 |
T |
|
| Q |
207 |
aactttgttgtatta |
221 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
7459852 |
aactttgttgtatta |
7459866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University