View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4941_high_12 (Length: 235)
Name: NF4941_high_12
Description: NF4941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4941_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 21 - 228
Target Start/End: Original strand, 37599894 - 37600101
Alignment:
| Q |
21 |
gataatgtgagtccagatccgtctcgattccctgtccattatatattaccattttacccttggaaacgcaagaaatacactacttttaatatctatccct |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37599894 |
gataatgtgagtccagatccgtctcgattccctgttcattatatattaccattttacccttggaaacgcaagaaatacactacttttaatatatatccct |
37599993 |
T |
 |
| Q |
121 |
tatacattctacattaccattttacccctgaatggctaccataaaataacttcattcaatttcgtgtcaatgtactttgttaaaaagttaattgtaggtc |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37599994 |
tatacattctacattaccattttacccctgaatggctaccataaaataacttcattcaatttcgtgtcaatgtactttgttaaaaagttaattgtaggtc |
37600093 |
T |
 |
| Q |
221 |
tctgtgat |
228 |
Q |
| |
|
|||||||| |
|
|
| T |
37600094 |
tctgtgat |
37600101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University