View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4941_high_15 (Length: 224)
Name: NF4941_high_15
Description: NF4941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4941_high_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 10 - 92
Target Start/End: Complemental strand, 14084930 - 14084849
Alignment:
| Q |
10 |
ggacatcatcagcatttaacatccgcatttaacaatctttttaaaggaaaaactttaatatgtttatgacaacatgatccaag |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
14084930 |
ggacatcatcagcatttaacatccgcatttaacaatctttttaaaggaaaaactttaata-atttacgacaacatgatccaag |
14084849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 144 - 196
Target Start/End: Complemental strand, 14084797 - 14084749
Alignment:
| Q |
144 |
tgattgggccatatatttatttctaaatggctcagtataaagatgataaaaaa |
196 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14084797 |
tgattgggccatat----atttctaaatggctcggtataaagatgataaaaaa |
14084749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University