View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4941_high_9 (Length: 242)
Name: NF4941_high_9
Description: NF4941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4941_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 53046434 - 53046202
Alignment:
| Q |
1 |
cagaatttgtaagatttccataccatgtaaaaacaacagactcactctgaagtatgtagcaataagaggaattcaaggcggaagcagcctggttgacgaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
53046434 |
cagaatttgtaagatttccataccatgtaaaaacaacggactcactctgaagtatgtagcaataagaggaattcaaggaggaagcagcctggttgacgaa |
53046335 |
T |
 |
| Q |
101 |
gacaatgaaaagaaaaattgtgattatttttattttattataaattgcccatacaaaatgaggggctagaatggccactacaaacagacaagatgacata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53046334 |
gacaatgaaaagaaaaattgtgattatttttattttattataaattgcccatacaaaatgaggggctagaatggccactacaaacagacaagatgacata |
53046235 |
T |
 |
| Q |
201 |
ctgagttaacttgtatagcttgcatactctctg |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
53046234 |
ctgagttaacttgtatagcttgcatactctctg |
53046202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 48 - 97
Target Start/End: Original strand, 15960771 - 15960820
Alignment:
| Q |
48 |
tgaagtatgtagcaataagaggaattcaaggcggaagcagcctggttgac |
97 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
15960771 |
tgaagtatatagcaataagaggaattcaaggaagaagcaacctggttgac |
15960820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University