View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4941_low_11 (Length: 238)
Name: NF4941_low_11
Description: NF4941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4941_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 167
Target Start/End: Original strand, 1328160 - 1328326
Alignment:
| Q |
1 |
ctattacaccgcaaatcacaattaacacgtgtgatagagtagaccgataattggaattctttgctgattttgtatgtgtttggtttagcttttgtagtgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
1328160 |
ctattacaccgcaaatcacaattaacacgtgtgatagagtagaccgataattggaattctttgctgattttgtatgcgtttggtttagcttttctagtgt |
1328259 |
T |
|
| Q |
101 |
tagacatacgtttagcatgtcattttaccgtgaatttttgaagctagaattttcagcttctagtaga |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1328260 |
tagacatacgtttagcatgtcattttaccgtgaatttgtgaagctagaattttcagcttctagtaga |
1328326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 44187020 - 44187079
Alignment:
| Q |
1 |
ctattacaccgcaaatcacaattaacacgtgtgatagagtagaccgataattggaattct |
60 |
Q |
| |
|
|||||| ||| |||||| ||||||||||||| ||||||||| | |||||||||||||||| |
|
|
| T |
44187020 |
ctattataccccaaatcgcaattaacacgtgcgatagagtaaatcgataattggaattct |
44187079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University