View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4941_low_11 (Length: 238)

Name: NF4941_low_11
Description: NF4941
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4941_low_11
NF4941_low_11
[»] chr4 (2 HSPs)
chr4 (1-167)||(1328160-1328326)
chr4 (1-60)||(44187020-44187079)


Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 167
Target Start/End: Original strand, 1328160 - 1328326
Alignment:
1 ctattacaccgcaaatcacaattaacacgtgtgatagagtagaccgataattggaattctttgctgattttgtatgtgtttggtttagcttttgtagtgt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||    
1328160 ctattacaccgcaaatcacaattaacacgtgtgatagagtagaccgataattggaattctttgctgattttgtatgcgtttggtttagcttttctagtgt 1328259  T
101 tagacatacgtttagcatgtcattttaccgtgaatttttgaagctagaattttcagcttctagtaga 167  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
1328260 tagacatacgtttagcatgtcattttaccgtgaatttgtgaagctagaattttcagcttctagtaga 1328326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 44187020 - 44187079
Alignment:
1 ctattacaccgcaaatcacaattaacacgtgtgatagagtagaccgataattggaattct 60  Q
    |||||| ||| |||||| ||||||||||||| ||||||||| | ||||||||||||||||    
44187020 ctattataccccaaatcgcaattaacacgtgcgatagagtaaatcgataattggaattct 44187079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University