View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4942-Insertion-4 (Length: 133)
Name: NF4942-Insertion-4
Description: NF4942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4942-Insertion-4 |
 | |
|
| [»] chr6 (4 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 124; Significance: 1e-64; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 124; E-Value: 1e-64
Query Start/End: Original strand, 8 - 133
Target Start/End: Complemental strand, 4369108 - 4368983
Alignment:
| Q |
8 |
gttatggtggtttccctcttcaggatgcgttcgagatggtargatgataaaaactattaaatatgaattgtaaaatacctactgctgtctaatcttattt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4369108 |
gttatggtggtttccctcttcaggatgcgttcgagatggtaagatgataaaaactattaaatatgaattgtaaaatacctactgctgtctaatcttattt |
4369009 |
T |
|
| Q |
108 |
gtatttgtttaggtccactctaagag |
133 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
4369008 |
gtatttgtttaggtccactctaagag |
4368983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 66; E-Value: 9e-30
Query Start/End: Original strand, 37 - 133
Target Start/End: Complemental strand, 4364679 - 4364577
Alignment:
| Q |
37 |
ttcgagatggtargatgataaaaactattaaatatgaattgtaaaatacctactgctgtctaatct------tatttgtatttgtttaggtccactctaa |
130 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||| ||||||||||||||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
4364679 |
ttcgagatggtaagatgataaaaactattgaatatgaattttaaaatacctactgctgtctaatctgaattgtatttgtatatgtttaggtccactctaa |
4364580 |
T |
|
| Q |
131 |
gag |
133 |
Q |
| |
|
||| |
|
|
| T |
4364579 |
gag |
4364577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 39; E-Value: 0.0000000000001
Query Start/End: Original strand, 39 - 115
Target Start/End: Original strand, 4415612 - 4415688
Alignment:
| Q |
39 |
cgagatggtargatgataaaaactattaaatatgaattgtaaaatacctactgctgtctaatcttatttgtatttgt |
115 |
Q |
| |
|
|||||||||| ||||||||||| ||| |||||||||||||||||||||||| || || || ||| |||||||||| |
|
|
| T |
4415612 |
cgagatggtaagatgataaaaaacattgaatatgaattgtaaaatacctactacttgcttatattaattgtatttgt |
4415688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 36; E-Value: 0.000000000009
Query Start/End: Original strand, 37 - 90
Target Start/End: Complemental strand, 4359302 - 4359249
Alignment:
| Q |
37 |
ttcgagatggtargatgataaaaactattaaatatgaattgtaaaatacctact |
90 |
Q |
| |
|
|||||||||||| ||||||||| | |||| ||||||||||||||||||| |||| |
|
|
| T |
4359302 |
ttcgagatggtaagatgataaagaatattgaatatgaattgtaaaatacgtact |
4359249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University