View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4944-Insertion-2 (Length: 260)
Name: NF4944-Insertion-2
Description: NF4944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4944-Insertion-2 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 8 - 260
Target Start/End: Original strand, 1989552 - 1989819
Alignment:
| Q |
8 |
gaagaatcacttcatcttccaataaccctttttcaaaatcttctcctagaggaagtaatgggtttgacttcaataggaacccttcatcaccttctggtaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1989552 |
gaagaatcacttcatcttccaataaccctttttcaaaatcttctcctagaggaagtaatgggtttgacttcaataggaacccttcatcaccttctggtaa |
1989651 |
T |
 |
| Q |
108 |
tgtttggtcacaaccctcttttccaaagaaccctattagtccaaagtttaatcctttaatgtcttatgagaatatccaaggtggtgt------------- |
194 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1989652 |
tgtttggtcacaaccctctttcccaaagaaccctattagtccaaagtttaatcctttaatgtcttatgagaatatccaaggtggtgttggtgttgttggt |
1989751 |
T |
 |
| Q |
195 |
--tggcggcggcagtggtgctggtggttcctgtgctttttcaccaagggttaataatggtgattatga |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1989752 |
ggtggcggcggcagtggtgctggtggttcctgtgctttttcaccaagggttaataatggtgattatga |
1989819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University