View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4944-Insertion-3 (Length: 183)
Name: NF4944-Insertion-3
Description: NF4944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4944-Insertion-3 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 8 - 183
Target Start/End: Complemental strand, 37726762 - 37726587
Alignment:
| Q |
8 |
ttaattgtatcttagcatgatctgactgtttactctcatatgcattatttgtgatttgtgaataatcttggtggcatgacttccatcaggatttaaccga |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37726762 |
ttaattgtatcttagcatgatctgactgtttactctcatatgcattatttgtgatttgtgaataatcttggtggcatgacttccatcaggatttaaccga |
37726663 |
T |
|
| Q |
108 |
agagaacagaaaaacaacaccccgagactatctggaacttgctttgcagtctgttcaagggaacagaaacaatgaa |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37726662 |
agagaacagaaaaacaacaccccgagactatctggaacttgctttgcagtctgttcaagggaacagaaacaatgaa |
37726587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 73; Significance: 1e-33; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 73; E-Value: 1e-33
Query Start/End: Original strand, 61 - 177
Target Start/End: Original strand, 34810181 - 34810297
Alignment:
| Q |
61 |
atttgtgaataatcttggtggcatgacttccatcaggatttaaccgaagagaacagaaaaacaacaccccgagactatctggaacttgctttgcagtctg |
160 |
Q |
| |
|
||||||||||||||||||||||| |||||| || ||| ||||| ||||| |||||||||| ||| || ||||||||||||||||||||||||| ||||| |
|
|
| T |
34810181 |
atttgtgaataatcttggtggcaggacttctatttggacttaactgaagataacagaaaaataactccacgagactatctggaacttgctttgcggtctg |
34810280 |
T |
|
| Q |
161 |
ttcaagggaacagaaac |
177 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
34810281 |
ttcaagggaacagaaac |
34810297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University