View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4944-Insertion-4 (Length: 134)
Name: NF4944-Insertion-4
Description: NF4944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4944-Insertion-4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 75; Significance: 6e-35; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 75; E-Value: 6e-35
Query Start/End: Original strand, 55 - 133
Target Start/End: Original strand, 49447569 - 49447647
Alignment:
| Q |
55 |
ggtttctaaatcttgaatgcaacatattttaggtatatatgatacctttctaattcaattacatttaaatgttttccaa |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
49447569 |
ggtttctaaatcttgaatgcaacatattttaggtatatatgatgcctttctaattcaattacatttaaatgttttccaa |
49447647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University