View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4945-Insertion-9 (Length: 148)
Name: NF4945-Insertion-9
Description: NF4945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4945-Insertion-9 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 8 - 148
Target Start/End: Complemental strand, 52324303 - 52324163
Alignment:
| Q |
8 |
atatactttcttgttttgtaaggttaattgataccttgttcactgaattcatttttcagatattgcctcaagctgtttgtacacgatatggattgccggt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
52324303 |
atatactttcttgttttgtaaggttaattaataccttgttcactgaattcatttttcagatattgcctcaagctgtttgtacacgatatggattgctggt |
52324204 |
T |
|
| Q |
108 |
tggagctacgctagcgccgcttgttcgtgttcttcttttag |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52324203 |
tggagctacgctagcgccgcttgttcgtgttcttcttttag |
52324163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University