View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4945_high_17 (Length: 225)
Name: NF4945_high_17
Description: NF4945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4945_high_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 5674649 - 5674851
Alignment:
| Q |
1 |
attcactttgtgtagatttgcaagtcaaatttggtacaaaatcttaaaatggattggtgcgtcaatggttttttcgacaaatttattcaccttattgaga |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
5674649 |
attcattttgtgtagatttgcaagtcaaatttggtacaaaatcttaaaatggattggtgcgtcgatggttttttcgacaaatttattcaccttattgaga |
5674748 |
T |
|
| Q |
101 |
gtatgcttagataggagaaaatcatgttcatctattttttctttgtgggtgtaattaccacttgtacttatcacaatatatgagagtagtacaccaacaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5674749 |
gtatgcttagataggagaaaatcatgttcatctattttttc--tgtgggtgtaattaccacttgtacttatcacaatatatgagagtagtacaccaacaa |
5674846 |
T |
|
| Q |
201 |
ggttg |
205 |
Q |
| |
|
||||| |
|
|
| T |
5674847 |
ggttg |
5674851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University