View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4945_high_19 (Length: 205)

Name: NF4945_high_19
Description: NF4945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4945_high_19
NF4945_high_19
[»] chr8 (1 HSPs)
chr8 (20-186)||(4146531-4146697)


Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 20 - 186
Target Start/End: Complemental strand, 4146697 - 4146531
Alignment:
20 gcacctttgaatggtcttagtctctgatttatgcaggaattgccccctctcttgatctcacagttacgtgcgattgcaagcagaagaattcataagaaat 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
4146697 gcacctttgaatggtcttagtctctgatttatgcaggaattgccccctctcttgatctctcagttacgtgcgattgcaagcagaagaattcataagaaat 4146598  T
120 tcgcaaattgatttgaagaattcgaagatgtaatgaaattaaatgctttatatatattcttggacat 186  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||    
4146597 tcgcaaattgatttgaagaattcgaagatgtaatgaaattaaatgctttatatatatctttggacat 4146531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University