View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4945_low_10 (Length: 313)
Name: NF4945_low_10
Description: NF4945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4945_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 22 - 300
Target Start/End: Original strand, 560153 - 560432
Alignment:
| Q |
22 |
caaggatcatatcctttaatttcaggttgcaaacttggagtgtttgagggtaaaaaccatacttacattggtgattgcatggtgaataaaattctaggaa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
560153 |
caaggatcatatcctttaatttcaggttgcaaacttggagtgtttgagggtaaaaaccatacttacattggtgattgcatggtgaataaaattctaggaa |
560252 |
T |
 |
| Q |
122 |
aatgtaggggcttgaatgtaacaaagattatttgtgtgactcaagaccaatttctttgtgcattatcta-nnnnnnnatagtatctcatatcattgctta |
220 |
Q |
| |
|
|||||||| | |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
560253 |
aatgtaggtgtttgaatgtaaaaaagattatttgtgtgactcaagaccaatttctttgtgcattatctattttttttatagtatctcatatcattgctta |
560352 |
T |
 |
| Q |
221 |
ttattcttttgcacttattgaataacctcatagcattagcatttttcatagaaacaagatattatttctgtactaccttc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
560353 |
ttattcttttgcacttattgaataacctcatagcattagcatttttcatagaaacaagatattatttctgtactaccttc |
560432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University