View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4945_low_16 (Length: 241)
Name: NF4945_low_16
Description: NF4945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4945_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 5 - 187
Target Start/End: Complemental strand, 33186771 - 33186589
Alignment:
| Q |
5 |
agatggcgagctacatacttggctttccatatggttagtgatcttcataaataaacctttatttgaccacatatatataatatggtattgataacactaa |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33186771 |
agatggcgagctacatacttggctttccatatggttagtgatcttcataaataaacctttatttgaccacatatatataatatggtattgataacactaa |
33186672 |
T |
 |
| Q |
105 |
aaaacaaattacattttcacaaaccaatagtgtatgctatatgtgtcactatcattctcatacatttatatctcaaaattgaa |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33186671 |
aaaacaaattacattttcacaaaccaatagtgtatgctatatgtgtcactatcattctcatacatttatatctcaaaattgaa |
33186589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 212 - 241
Target Start/End: Complemental strand, 33186560 - 33186531
Alignment:
| Q |
212 |
gtttgaaataatgaattaacttcattttat |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
33186560 |
gtttgaaataatgaattaacttcattttat |
33186531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University