View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4945_low_19 (Length: 211)
Name: NF4945_low_19
Description: NF4945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4945_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 20 - 195
Target Start/End: Original strand, 25415062 - 25415238
Alignment:
| Q |
20 |
acaatttccacagaacaattacaacattgtccaatctttttgtgtctttatagttgagaca-atcgttaacgtggttcaactgatccttcaagtcaaaca |
118 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| | | ||||||||||||||| |||||||||||||||||| |
|
|
| T |
25415062 |
acaatttcaacaaaacaattacaacattgtccaatctttttgtgtctttatagttgagactgaccattaacgtggttcaaccgatccttcaagtcaaaca |
25415161 |
T |
|
| Q |
119 |
acgtgacatcaatgttgccccatattgtagtaaactgcaactagttttgtgtttatatctaatgtataagtgttcat |
195 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25415162 |
gcgtgacatcaatgttgtcccacattgtagtaaactgcaactagttttgtgtttatatctaatgtataagtgttcat |
25415238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 136 - 195
Target Start/End: Complemental strand, 35375897 - 35375838
Alignment:
| Q |
136 |
ccccatattgtagtaaactgcaactagttttgtgtttatatctaatgtataagtgttcat |
195 |
Q |
| |
|
||||||||||||||| |||||| ||||||| ||||| ||||||| || |||| ||||||| |
|
|
| T |
35375897 |
ccccatattgtagtacactgcatctagtttagtgttcatatctactggataattgttcat |
35375838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University