View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4946-Insertion-6 (Length: 74)
Name: NF4946-Insertion-6
Description: NF4946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4946-Insertion-6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 62; Significance: 2e-27; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 62; E-Value: 2e-27
Query Start/End: Original strand, 8 - 73
Target Start/End: Original strand, 22730367 - 22730432
Alignment:
| Q |
8 |
ctaattagatgctaaatttcaaagttaaaacaaattacttttgatattgtttcgttttatgttgtt |
73 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22730367 |
ctaattagatgcaaaatttcaaagttaaaacaaattacttttgatattgtttcgttttatgttgtt |
22730432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 2e-17
Query Start/End: Original strand, 22 - 74
Target Start/End: Complemental strand, 3168541 - 3168489
Alignment:
| Q |
22 |
aatttcaaagttaaaacaaattacttttgatattgtttcgttttatgttgttg |
74 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3168541 |
aatttcaaagttagaacaaattacttttgatattgtttggttttatgttgttg |
3168489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University