View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4946_high_15 (Length: 265)

Name: NF4946_high_15
Description: NF4946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4946_high_15
NF4946_high_15
[»] chr3 (1 HSPs)
chr3 (32-265)||(36937747-36937980)


Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 32 - 265
Target Start/End: Complemental strand, 36937980 - 36937747
Alignment:
32 tgcacatatctacaagggtacttttcaagttgattgaggttttggaaggtgccgtgctacaatgttaagatgagtttagaatctttggatatgcacctga 131  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36937980 tgcacatatctacaagggtacttttcaagttgattgaggttttggaaggtgccgtgctacaatgttaagatgagtttagaatctttggatatgcacctga 36937881  T
132 ttcagaattgaagtttcgatcactttttctttatatttcgattcgagttataattataagtatatgaaaattgctttatccgtcctcaagtttctcggcc 231  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
36937880 ttcagaattgaagtttcgatcactttttctttatatttcgattcgagttataattgtaagtatatgaaaattgctttatccgtcctcaagtttctcggcc 36937781  T
232 attgaaaataagtaaatcagaacttacaacttga 265  Q
    ||||||||||||||||||||||||||||||||||    
36937780 attgaaaataagtaaatcagaacttacaacttga 36937747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University