View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4946_high_15 (Length: 265)
Name: NF4946_high_15
Description: NF4946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4946_high_15 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 32 - 265
Target Start/End: Complemental strand, 36937980 - 36937747
Alignment:
| Q |
32 |
tgcacatatctacaagggtacttttcaagttgattgaggttttggaaggtgccgtgctacaatgttaagatgagtttagaatctttggatatgcacctga |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36937980 |
tgcacatatctacaagggtacttttcaagttgattgaggttttggaaggtgccgtgctacaatgttaagatgagtttagaatctttggatatgcacctga |
36937881 |
T |
 |
| Q |
132 |
ttcagaattgaagtttcgatcactttttctttatatttcgattcgagttataattataagtatatgaaaattgctttatccgtcctcaagtttctcggcc |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36937880 |
ttcagaattgaagtttcgatcactttttctttatatttcgattcgagttataattgtaagtatatgaaaattgctttatccgtcctcaagtttctcggcc |
36937781 |
T |
 |
| Q |
232 |
attgaaaataagtaaatcagaacttacaacttga |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
36937780 |
attgaaaataagtaaatcagaacttacaacttga |
36937747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University