View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4946_high_16 (Length: 252)
Name: NF4946_high_16
Description: NF4946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4946_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 169 - 225
Target Start/End: Original strand, 1514959 - 1515015
Alignment:
| Q |
169 |
ttttcggcttccattattgacccgttttgttatccgctatttgttatatcagatttt |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1514959 |
ttttcggcttccattattgacccgttttgttatccgctatttgttatatcggatttt |
1515015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 163 - 240
Target Start/End: Original strand, 1492256 - 1492333
Alignment:
| Q |
163 |
aaccatttttcggcttccattattgacccgttttgttatccgctatttgttatatcagatttttggctatccgatatt |
240 |
Q |
| |
|
|||| |||| |||||||| ||||| |||| ||| |||||||||||||||||||| |||||||||| |||| ||||| |
|
|
| T |
1492256 |
aaccgttttgcggcttccgctattggcccgcttttctatccgctatttgttatatcggatttttggcgatcctatatt |
1492333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University