View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4946_high_20 (Length: 239)
Name: NF4946_high_20
Description: NF4946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4946_high_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 150
Target Start/End: Complemental strand, 23382315 - 23382166
Alignment:
| Q |
1 |
atgattgaaagaaaaaata-tagtttgatgaataatgaattaaggatgcgacaacacatttatttgtgaattaatatcatcataatannnnnnnacaata |
99 |
Q |
| |
|
||||||||||||||||| | ||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| || |
|
|
| T |
23382315 |
atgattgaaagaaaaaaaaatagttatatgaataatgaattaaagatgcgacaacacatttatttgtgaattaatatcatcataata-ttttttacatta |
23382217 |
T |
|
| Q |
100 |
attgacatatatgtgatagtatggataaaagacccaaaccgaatgccagtt |
150 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
23382216 |
attgacatatatgtgatcgtatggataaaagacccaaaccgaatgccagtt |
23382166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University