View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4946_low_18 (Length: 251)
Name: NF4946_low_18
Description: NF4946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4946_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 23382319 - 23382558
Alignment:
| Q |
1 |
ttattattgtgtctctttttggattattccctctctattacgaaaggctaaaaggtaaataaaatgataaattttgatgatcttcatgattattataaga |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |||| | |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
23382319 |
ttattattgtgtctctttttggatcattccctctctattacgaaaggttaaa-gataaataaaatgataaattttgatgatcttcatgattatcataaga |
23382417 |
T |
|
| Q |
101 |
gatctttattaaggttaaataatattttgagtggaaaggaaaatttattgatatcatcagcttacatgtctaaattacacatgtcctgtatgggatttta |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |
|
|
| T |
23382418 |
gatctttataaaggttaaataatattttgagtggaaaggaaaatttattgatatcatcagcttatatgtctaaattacacatgtcttgtatgggatttta |
23382517 |
T |
|
| Q |
201 |
aatcagtcttataaaaatacaaattcaagttctaatctctg |
241 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
23382518 |
aatcagtcttataaaattacaaattcaagttctaatctctg |
23382558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University