View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4946_low_21 (Length: 239)

Name: NF4946_low_21
Description: NF4946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4946_low_21
NF4946_low_21
[»] chr7 (1 HSPs)
chr7 (1-150)||(23382166-23382315)


Alignment Details
Target: chr7 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 150
Target Start/End: Complemental strand, 23382315 - 23382166
Alignment:
1 atgattgaaagaaaaaata-tagtttgatgaataatgaattaaggatgcgacaacacatttatttgtgaattaatatcatcataatannnnnnnacaata 99  Q
    ||||||||||||||||| | |||||  |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||       ||| ||    
23382315 atgattgaaagaaaaaaaaatagttatatgaataatgaattaaagatgcgacaacacatttatttgtgaattaatatcatcataata-ttttttacatta 23382217  T
100 attgacatatatgtgatagtatggataaaagacccaaaccgaatgccagtt 150  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||    
23382216 attgacatatatgtgatcgtatggataaaagacccaaaccgaatgccagtt 23382166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University