View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4947_high_1 (Length: 248)
Name: NF4947_high_1
Description: NF4947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4947_high_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 6068246 - 6068478
Alignment:
| Q |
1 |
ctatgactctgattccgtgcttccattgacagaatggaatccaggtcacacgcagtggtagtctggt--agatttcatttgtcgagcatttcttggtgca |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||| |
|
|
| T |
6068246 |
ctatgactctgattccgtgcttccattgacagaaaggaatccaggtcacacgcagtggtagtctggtgtagatttcatttgtcgagcatttcttggcgca |
6068345 |
T |
 |
| Q |
99 |
ttttggaataatctatcaatatcagaagccaaagtagtaaaggagatagtatgacttggtagtcaaatttgttttacaagaatgacttgcggattgttac |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6068346 |
ttttggaataatctatcaatatcagaagccaaagtagtaaaggagatagtatgacttgctagtcaaatttgttttacaagaatgacttgcggattgttac |
6068445 |
T |
 |
| Q |
199 |
tggagtatgaagccacattagtaaaggagatgc |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
6068446 |
tggagtatgaagccacattagtaaaggagatgc |
6068478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University