View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4948_high_6 (Length: 294)
Name: NF4948_high_6
Description: NF4948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4948_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 249
Target Start/End: Original strand, 42096403 - 42096653
Alignment:
| Q |
1 |
caaacatatataaataaataataagatttctttgtgcggaattttgcctccacaacattattattgactaactgt--ttttattggattaggacccaaca |
98 |
Q |
| |
|
||||| |||||||| ||||||||||| |||||||||||||| |||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42096403 |
caaacttatataaaataataataagatgtctttgtgcggaatgttgcctccacgacattattattgactaactgtgtttttattggattaggacccaaca |
42096502 |
T |
|
| Q |
99 |
aatagagaaagtgtgaaagatttggtaaaaatgaattatcgcagtctgcagatgtgtgctgtaatttccaagcgtcttattactttttcattatgtgatt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42096503 |
aatagagaaagtgtgaaagatttggtaaaaattaatcatcgcagtctgcagatgtgtgctgtaatttccaagcgtcttattactttttcattatgtgatt |
42096602 |
T |
|
| Q |
199 |
tgaaagtgagattatttatgctgactggggatagcagtgtagatgttagta |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42096603 |
tgaaagtgagattatttatgctgactggggatagcagtgtagatgttagta |
42096653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University