View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4948_low_8 (Length: 291)
Name: NF4948_low_8
Description: NF4948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4948_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 19 - 284
Target Start/End: Original strand, 6227145 - 6227410
Alignment:
| Q |
19 |
tgtttatcatccagttattcgtgttgattatacacctccgattgcgggtatgtttgtaccctcatacctgaaggcttttgtgaaagagatgactactctg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6227145 |
tgtttatcatccagttattcgtgttgattatacacctccgattgcgggtatgtttgtacctccatacctgaaggcttttgtgaaagagatgactactctg |
6227244 |
T |
 |
| Q |
119 |
tcctccgatgacaagaacaagaattcttttctggtagtcgtaggcaacctcccgcccgagacaaggaaccatgatttgcttcaacttttccagccttttg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6227245 |
tcctccgatgacaagaacaagaattcttttctggtagtaggaggcaacctcccacccgagacaaggaaccatgatttgcttcaacttttccagccttttg |
6227344 |
T |
 |
| Q |
219 |
gtcatgtcatcggtgccgatgttgctattgctcatcacactggccttagtggccgttttgcctttg |
284 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6227345 |
gtcatgtcatcggtgccgatattgctattgctcaacacactggccttagtggccgttttgcctttg |
6227410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University