View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4950-Insertion-3 (Length: 323)
Name: NF4950-Insertion-3
Description: NF4950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4950-Insertion-3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 8 - 245
Target Start/End: Complemental strand, 47285523 - 47285286
Alignment:
| Q |
8 |
gttggaccatctactcaagagattgcaccaccaggttattaccttttgtttttggtgcatgctggtgtgcctagttcaggtgagtgggtgcaactcatgt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47285523 |
gttggaccatctactcaagagattgcaccaccaggttattaccttttgtttttggtgcatgctggtgtgcctagttcaggtgagtgggtgcaactcatgt |
47285424 |
T |
|
| Q |
108 |
aataatgtagttgcagatattggtttgttagattagattgatttgttaggaggattgtattaggttagattagatgtttgcaaattaattatcatggaga |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47285423 |
aataatgtagttgcagatattggtttgttagattagattgatttgttaggaggattgtattaggttagattagatgtttgcaaattaattatcatggaga |
47285324 |
T |
|
| Q |
208 |
atgtattttgtttaagttttaggtaggtcatagtttgc |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47285323 |
atgtattttgtttaagttttaggtaggtcatagtttgc |
47285286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University