View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4950-Insertion-4 (Length: 173)
Name: NF4950-Insertion-4
Description: NF4950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4950-Insertion-4 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 2e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 2e-84
Query Start/End: Original strand, 8 - 173
Target Start/End: Original strand, 19719798 - 19719962
Alignment:
| Q |
8 |
gtttgtgaatccttagtgatctcacatgcatatgttctttgtttgtaccaagacaaaagaatgttgggagggcattggtttagtaacaatggtccgggag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19719798 |
gtttgtgaatccttagtgatctcacatgcatatgttctttgtttgtaccaagacaaaagaatgttgggagggcattggtttagtaacaatggtccgggag |
19719897 |
T |
 |
| Q |
108 |
ttgctccaccaagctaacaattttacaactctattgtttgaattttttggcaggttgcctcctccc |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
19719898 |
ttgctccaccaagctaacaattttacaactctattg-ttgaattttttggcaggttgcctcctccc |
19719962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University