View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4950_high_5 (Length: 350)
Name: NF4950_high_5
Description: NF4950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4950_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 22 - 341
Target Start/End: Original strand, 45794552 - 45794871
Alignment:
| Q |
22 |
attccatagttatcactaaatttacaccaaccttttggacgtacaacatcaccaagaaatgattccattatgattgttcttgaatattggtcacgcggag |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45794552 |
attccatagttatcactaaatttacaccaaccttttggacgtacaacatcaccaagaaatgattccattatgattgttcttgaatattggtcacgcggag |
45794651 |
T |
 |
| Q |
122 |
ttcccaaacatgtcgaaccaacaagacttttatcactgattttgccttgttctgctatgatggtgcagttttggatcacaagtccagttttctcatattt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45794652 |
ttcccaaacatgtcgaaccaacaagacttttatcattgattttgccttgttctgctatgatggtgcagttttggatcacaagtccagttttctcatattt |
45794751 |
T |
 |
| Q |
222 |
gtctagtcttgattgaacactcaccacattttttctcagagctaagctagaagaatttcgatgcttcacaattatttgcgagttttgaattatagttgct |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45794752 |
gtctagtcttgattgaacactcaccacattttttctcagagctaagctagaagaatttcggtgcttcacaattatttgcgagttttgaattatagttgct |
45794851 |
T |
 |
| Q |
322 |
gagtctcctttgatgatgtc |
341 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
45794852 |
gagtctcctttgatgatgtc |
45794871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University