View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4950_low_10 (Length: 250)
Name: NF4950_low_10
Description: NF4950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4950_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 80; Significance: 1e-37; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 133 - 232
Target Start/End: Complemental strand, 28741621 - 28741522
Alignment:
| Q |
133 |
gggttatgggtttctggtttttgggatttgttgcattgcattgcatgtgtttttatatggtgggtcccactgggaatagaatagtgatgatcccaatctt |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || ||||||||||| ||||| ||||||||| |
|
|
| T |
28741621 |
gggttatgggtttctggtttttgggatttgttgcattgcattgcatatgtttttatatggtgggtcccattgtgaatagaatagagatgaccccaatctt |
28741522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 28741753 - 28741683
Alignment:
| Q |
1 |
ttgttgcttctagtggaattgcattcagtggtaattaatctaacctaatttggtttaatctaattaccccc |
71 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28741753 |
ttgttgcttctagtggaattgcattcagtggtaattaatctaacctaatttggtttaatctaattaccccc |
28741683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 28750598 - 28750554
Alignment:
| Q |
1 |
ttgttgcttctagtggaattgcattcagtggtaattaatctaacc |
45 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||| || ||||||| |
|
|
| T |
28750598 |
ttgttgctgctagtggaattgcattcagcggtaactattctaacc |
28750554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000006; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 137 - 185
Target Start/End: Original strand, 39941324 - 39941372
Alignment:
| Q |
137 |
tatgggtttctggtttttgggatttgttgcattgcattgcatgtgtttt |
185 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
39941324 |
tatgggtttctggttttttcgatttgttgcattgctttgcatgtgtttt |
39941372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 37
Target Start/End: Original strand, 39941180 - 39941216
Alignment:
| Q |
1 |
ttgttgcttctagtggaattgcattcagtggtaatta |
37 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39941180 |
ttgttgctgctagtggaattgcattcagtggtaatta |
39941216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University