View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4950_low_7 (Length: 328)
Name: NF4950_low_7
Description: NF4950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4950_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 13 - 312
Target Start/End: Complemental strand, 10334721 - 10334423
Alignment:
| Q |
13 |
tgaaacaatgacaaaggttattaatgttaaaccttttagatgaagtgcctattttgggatgtgcggggcttggtcaatgccccgtcaagattggctctca |
112 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10334721 |
tgaaacaataacaaaggttattaatgttaaaccttttagatgaagtgcctattttgggatgtgcggggcttggtcaatgccccgtcaagattggctctca |
10334622 |
T |
 |
| Q |
113 |
agagacttgtagatgagtataatcgcgatacatgcttaaatgcagaaacatggatgaatttttacagaatagcagaaacttatagaaattggttaagtag |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10334621 |
agagacttgtagatgagtataatcgcgatacatgcttaaatgcagaaacatggatgaatttttatagaatagcagaaacttatagaaattggttgagtag |
10334522 |
T |
 |
| Q |
213 |
aatagctttcaaattgtttacctttgaataagagagtgaatttgctgccaaatttatggcgtctttgtgcaaatgatattaatcctgctattgttgccac |
312 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10334521 |
aatagctttcaaattgtttacc-ttgaataagagagtgaatttgctgctaaatttatggcgtctttgtgcaaatgatattaatcctgctatcgttgccac |
10334423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University