View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4950_low_8 (Length: 255)
Name: NF4950_low_8
Description: NF4950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4950_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 19 - 247
Target Start/End: Complemental strand, 3133502 - 3133274
Alignment:
| Q |
19 |
tatcacgtaacaatagctatttgttcaaatcccataggccacaacgctatagcaccactatttgtaccctagcccgttgttaagcattaaatctcacaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3133502 |
tatcacgtaacaatagctatttgttcaaatcccacaggccacaacgctatagcaccactatttgtaccctagcccgctgttaagcattaaatctcacaat |
3133403 |
T |
 |
| Q |
119 |
ttagaactacgatgtcaagctggagttatacttcttcgattgatctcattttacagcctagtaacttttgatagcttaaaactataggagaaagtttatg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3133402 |
ttagaactacgatgtcaagctggagttatacttcttcgattgatctcattttacagcctagtaacttttgatagcttaaaactttaggagaaagtttatg |
3133303 |
T |
 |
| Q |
219 |
gattccaaaccttctttattacctatgct |
247 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3133302 |
gattccaaaccttctttattacctatgct |
3133274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 79 - 154
Target Start/End: Original strand, 3122276 - 3122351
Alignment:
| Q |
79 |
tttgtaccctagcccgttgttaagcattaaatctcacaatttagaactacgatgtcaagctggagttatacttctt |
154 |
Q |
| |
|
||||||| |||||| ||||||||||||||| |||||| || | |||| |||||| |||||||||||| |||||| |
|
|
| T |
3122276 |
tttgtacattagccccttgttaagcattaaaactcacacttatgcactatgatgtccagctggagttatgcttctt |
3122351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University