View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4950_low_9 (Length: 253)
Name: NF4950_low_9
Description: NF4950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4950_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 138 - 243
Target Start/End: Original strand, 45795098 - 45795203
Alignment:
| Q |
138 |
ttatatgtgttgtttttagtactcggtagatattaatgtttttattttagtccctgtaaaactaattcttattattgataaagatgattatcttctttag |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45795098 |
ttatatgtgttgtttttagtactcggtagatattaatgtttttattttagtccctgtaaaactaattcttattattaataaagatgattatcttctttag |
45795197 |
T |
 |
| Q |
238 |
tctctg |
243 |
Q |
| |
|
|||||| |
|
|
| T |
45795198 |
tctctg |
45795203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 1 - 104
Target Start/End: Original strand, 45795003 - 45795106
Alignment:
| Q |
1 |
ctggtacgctagctggagctgtgaaacccatatctttgcagatgaatcttttgccctttaccactgcatttcacaagagtcaaaatcaaatgttgttatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45795003 |
ctggtacgctagctggagctgtgaaacccatatctttgcagatgaatcttttgccctttaccactgcatttcacaagagtgaaaatcaaatgttgttata |
45795102 |
T |
 |
| Q |
101 |
tgtg |
104 |
Q |
| |
|
|||| |
|
|
| T |
45795103 |
tgtg |
45795106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University