View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4950_low_9 (Length: 253)

Name: NF4950_low_9
Description: NF4950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4950_low_9
NF4950_low_9
[»] chr7 (2 HSPs)
chr7 (138-243)||(45795098-45795203)
chr7 (1-104)||(45795003-45795106)


Alignment Details
Target: chr7 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 138 - 243
Target Start/End: Original strand, 45795098 - 45795203
Alignment:
138 ttatatgtgttgtttttagtactcggtagatattaatgtttttattttagtccctgtaaaactaattcttattattgataaagatgattatcttctttag 237  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
45795098 ttatatgtgttgtttttagtactcggtagatattaatgtttttattttagtccctgtaaaactaattcttattattaataaagatgattatcttctttag 45795197  T
238 tctctg 243  Q
    ||||||    
45795198 tctctg 45795203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 1 - 104
Target Start/End: Original strand, 45795003 - 45795106
Alignment:
1 ctggtacgctagctggagctgtgaaacccatatctttgcagatgaatcttttgccctttaccactgcatttcacaagagtcaaaatcaaatgttgttatg 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||     
45795003 ctggtacgctagctggagctgtgaaacccatatctttgcagatgaatcttttgccctttaccactgcatttcacaagagtgaaaatcaaatgttgttata 45795102  T
101 tgtg 104  Q
    ||||    
45795103 tgtg 45795106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University