View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4951-Insertion-7 (Length: 272)
Name: NF4951-Insertion-7
Description: NF4951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4951-Insertion-7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 8 - 115
Target Start/End: Complemental strand, 23436183 - 23436076
Alignment:
| Q |
8 |
tcaacaaactgcatgccaccataaacattgttggcaaaacgcacaccaactgtgaaagccagagcaactggtggaacctgttttgccattggcgatgctt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23436183 |
tcaacaaactgcatgccaccataaacattgttggcaaaacgcacaccaactgtgaaagccagagcaactggtggaacctgttttgccattggcgatgctt |
23436084 |
T |
|
| Q |
108 |
ctaccaaa |
115 |
Q |
| |
|
|||||||| |
|
|
| T |
23436083 |
ctaccaaa |
23436076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 8 - 147
Target Start/End: Complemental strand, 23471669 - 23471534
Alignment:
| Q |
8 |
tcaacaaactgcatgccaccataaacattgttggcaaaacgcacaccaactgtgaaagccagagcaactggtggaacctgttttgccattggcgatgctt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
23471669 |
tcaacaaactgcatgccaccataaacattgttggcaaaacgcacactaactgtgaaagcgagagcaactggtggaacctgttttaccattggcgatgctt |
23471570 |
T |
|
| Q |
108 |
ctaccaaaacgttcccaggtccattgatggacctggtatc |
147 |
Q |
| |
|
||||| ||||||||| |||||||||| ||||||||||| |
|
|
| T |
23471569 |
ctacc-aaacgttcc--agtccattgat-gacctggtatc |
23471534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University