View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4951_high_1 (Length: 597)
Name: NF4951_high_1
Description: NF4951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4951_high_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 3e-71; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 3e-71
Query Start/End: Original strand, 440 - 576
Target Start/End: Original strand, 42078812 - 42078948
Alignment:
| Q |
440 |
ttccgaagctttgatgtagatattatctggtataggaaatagaagtcgtgtgagacactaatatctacaaacttcattaaccatttaacctttatacatc |
539 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42078812 |
ttccgaagctttgatgtagatattatctggtataggaaatagaagtcgtgtgagacactaatatctacaaacttcattaaccatttaacctttatacatc |
42078911 |
T |
|
| Q |
540 |
tgaactataatttttgaaaagaataacatgttcacat |
576 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42078912 |
tgaactataatttttgaaaagaataacatgttcacat |
42078948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University