View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4952_high_10 (Length: 333)
Name: NF4952_high_10
Description: NF4952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4952_high_10 |
 | |
|
| [»] scaffold0008 (4 HSPs) |
| |
|
Alignment Details
Target: scaffold0008 (Bit Score: 197; Significance: 1e-107; HSPs: 4)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 133 - 333
Target Start/End: Original strand, 69070 - 69270
Alignment:
| Q |
133 |
acatattataaccaatcaaaggtctccacttacccaggtatagttctgatcatgttgttattttatttgaattagaagctaattttatgagagggaggaa |
232 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
69070 |
acatattataaccaatcaaaggtttccacttacccaggtatagttctgatcatgttgttattttatttgaattagaagctaattttatgagagggaggaa |
69169 |
T |
|
| Q |
233 |
gaaaagaaaacatatatttatatttgaagaggcttcgagaaaggatgaaaattatgaagaaattatcaggagtgtgtcgatggggtggggggagctacgt |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
69170 |
gaaaagaaaacatatatttatatttgaagaggcttcgagaaaggatgaaaattatgaagaaattatcaggagtgtgtcgatggggtggggggagctacgt |
69269 |
T |
|
| Q |
333 |
a |
333 |
Q |
| |
|
| |
|
|
| T |
69270 |
a |
69270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008; HSP #2
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 133 - 333
Target Start/End: Original strand, 76913 - 77113
Alignment:
| Q |
133 |
acatattataaccaatcaaaggtctccacttacccaggtatagttctgatcatgttgttattttatttgaattagaagctaattttatgagagggaggaa |
232 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
76913 |
acatattataaccaatcaaaggtttccacttacccaggtatagttctgatcatgttgttattttatttgaattagaagctaattttatgagagggaggaa |
77012 |
T |
|
| Q |
233 |
gaaaagaaaacatatatttatatttgaagaggcttcgagaaaggatgaaaattatgaagaaattatcaggagtgtgtcgatggggtggggggagctacgt |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
77013 |
gaaaagaaaacatatatttatatttgaagaggcttcgagaaaggatgaaaattatgaagaaattatcaggagtgtgtcgatggggtggggggagctacgt |
77112 |
T |
|
| Q |
333 |
a |
333 |
Q |
| |
|
| |
|
|
| T |
77113 |
a |
77113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008; HSP #3
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 69022 - 69072
Alignment:
| Q |
1 |
taaacgagttatggataactgcggactaattgatctaggatacaaaggaca |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
69022 |
taaacgagttatggataactgcggactaattgatctaggatacgaaggaca |
69072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008; HSP #4
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 76865 - 76915
Alignment:
| Q |
1 |
taaacgagttatggataactgcggactaattgatctaggatacaaaggaca |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
76865 |
taaacgagttatggataactgcggactaattgatctaggatacgaaggaca |
76915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University