View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4952_high_13 (Length: 318)
Name: NF4952_high_13
Description: NF4952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4952_high_13 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 315; Significance: 1e-178; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 315; E-Value: 1e-178
Query Start/End: Original strand, 4 - 318
Target Start/End: Original strand, 38322685 - 38322999
Alignment:
| Q |
4 |
tcattgtttcttccttccttacccaacccatttactatcatatacccatgtatctctctaccatgcatcaaggctgctagatgagtgcaagccggaagta |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38322685 |
tcattgtttcttccttccttacccaacccatttactatcatatacccatgtatctctctaccatgcatcaaggctgctagatgagtgcaagccggaagta |
38322784 |
T |
 |
| Q |
104 |
ctgttgtaactgtaaccaaatcaggctgaaccttattgccaagcatcctatcaaaaagcttcaaagttccgtaatgatcaccacaccgttgatgaactga |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38322785 |
ctgttgtaactgtaaccaaatcaggctgaaccttattgccaagcatcctatcaaaaagcttcaaagttccgtaatgatcaccacaccgttgatgaactga |
38322884 |
T |
 |
| Q |
204 |
tatgatcgaattccatgaaaacatatccttctcatccataacctcaaatacattcaaagcatcactagcacatttgcatttcccatacatatcaatcagt |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38322885 |
tatgatcgaattccatgaaaacatatccttctcatccataacctcaaatacattcaaagcatcactagcacatttgcatttcccatacatatcaatcagt |
38322984 |
T |
 |
| Q |
304 |
gcattcaaaacaaca |
318 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
38322985 |
gcattcaaaacaaca |
38322999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University