View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4953-Insertion-9 (Length: 52)
Name: NF4953-Insertion-9
Description: NF4953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4953-Insertion-9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 35; Significance: 0.00000000001; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000001
Query Start/End: Original strand, 8 - 42
Target Start/End: Original strand, 34687546 - 34687580
Alignment:
| Q |
8 |
atttttcagaccttgcaatttcagtcttcaaatat |
42 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
34687546 |
atttttcagaccttgcaatttcagtcttcaaatat |
34687580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000001
Query Start/End: Original strand, 8 - 42
Target Start/End: Original strand, 34709958 - 34709992
Alignment:
| Q |
8 |
atttttcagaccttgcaatttcagtcttcaaatat |
42 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
34709958 |
atttttcagaccttgcaatttcagtcttcaaatat |
34709992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000001
Query Start/End: Original strand, 8 - 49
Target Start/End: Original strand, 16230134 - 16230175
Alignment:
| Q |
8 |
atttttcagaccttgcaatttcagtcttcaaatatctcaaat |
49 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||| |||||| |
|
|
| T |
16230134 |
atttttcagactttgcaatttcactcttcaaatatttcaaat |
16230175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University