View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4953_low_5 (Length: 273)
Name: NF4953_low_5
Description: NF4953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4953_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 12 - 252
Target Start/End: Original strand, 10596521 - 10596761
Alignment:
| Q |
12 |
atgaatgatgccaaagagaatgtgacnnnnnnngactctaactcgatgagtaaacgacaatcaacatctccgcctaagggatccaagttacctcctgttt |
111 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10596521 |
atgaatgatgccaaagagaatgtgacaaaaaaagactctaactcgatgagtaaacgacgaccaacatctccgcctaagggatccaagttacctcctgttt |
10596620 |
T |
 |
| Q |
112 |
gtctgagagttgatccattgccaaggaagaaaaatggaaatggaagttcaaggtctccaagtccacctgcttcaaaagaacactcgaaagcaacatctgt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||| | |
|
|
| T |
10596621 |
gtctgagagttgatccattgccaaggaagaaaaatggaaatgggagttcaaggtctccaagtccacctgcttcaaaagaacacttgaaagcaacatcttt |
10596720 |
T |
 |
| Q |
212 |
tgaatcaaagaacattcctttgagagacatcaaagacagga |
252 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10596721 |
tggatcaaagaacattcctttgagagacatcaaagacagga |
10596761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University