View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4954-Insertion-3 (Length: 122)
Name: NF4954-Insertion-3
Description: NF4954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4954-Insertion-3 |
 | |
|
| [»] chr1 (5 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 114; Significance: 3e-58; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 3e-58
Query Start/End: Original strand, 9 - 122
Target Start/End: Original strand, 32894839 - 32894952
Alignment:
| Q |
9 |
aataaggaaacataatttgtttaattttcaaaatttttgtaggttctgtttgtctctcaatttgtactttgcaagcttgaagtatacttctccaaccttt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32894839 |
aataaggaaacataatttgtttaattttcaaaatttttgtaggttctgtttgtctctcaatttgtactttgcaagcttgaagtatacttctccaaccttt |
32894938 |
T |
|
| Q |
109 |
ctttcttccatgga |
122 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
32894939 |
ctttcttccatgga |
32894952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 7e-22
Query Start/End: Original strand, 56 - 120
Target Start/End: Original strand, 32950383 - 32950447
Alignment:
| Q |
56 |
gtttgtctctcaatttgtactttgcaagcttgaagtatacttctccaacctttctttcttccatg |
120 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
32950383 |
gtttgtctatcaatttgtactttgcaagcctgaagtatacttctccaacctttcttgcttccatg |
32950447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 49; E-Value: 2e-19
Query Start/End: Original strand, 64 - 120
Target Start/End: Original strand, 32884010 - 32884066
Alignment:
| Q |
64 |
ctcaatttgtactttgcaagcttgaagtatacttctccaacctttctttcttccatg |
120 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
32884010 |
ctcaatttgtactttgcaagcttaaagtatacttctccaacctttcttgcttccatg |
32884066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 49; E-Value: 2e-19
Query Start/End: Original strand, 56 - 120
Target Start/End: Original strand, 32934410 - 32934474
Alignment:
| Q |
56 |
gtttgtctctcaatttgtactttgcaagcttgaagtatacttctccaacctttctttcttccatg |
120 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||||||||||| |||||| |||||||| |
|
|
| T |
32934410 |
gtttgtctatcaatttgtactttgcaagcttaaagtatacttctccaacatttcttgcttccatg |
32934474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 45; E-Value: 4e-17
Query Start/End: Original strand, 64 - 120
Target Start/End: Original strand, 32918372 - 32918428
Alignment:
| Q |
64 |
ctcaatttgtactttgcaagcttgaagtatacttctccaacctttctttcttccatg |
120 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
32918372 |
ctcaatttgtattttgcaagcttaaagtatacttctccaacctttcttgcttccatg |
32918428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University