View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4954-Insertion-4 (Length: 343)
Name: NF4954-Insertion-4
Description: NF4954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4954-Insertion-4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-106; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 40 - 235
Target Start/End: Original strand, 54086072 - 54086267
Alignment:
| Q |
40 |
caatggagaaacggaaactcacgttttgatctgatccggggtgattagggtgaaattggggagtttgagaattggagaataatgtagttgggttttggag |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54086072 |
caatggagaaacggaaactcacgttttgatctgatccggggtgattagggtgaaattggggagtttgagaattggagaataatgtagttgggttttggag |
54086171 |
T |
|
| Q |
140 |
atgagaattcaaaccaattaagagtttttgtttcttttgtttgcgttcatcttcatcatcgttgttgttggaatatggatcgttgattaaattggg |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54086172 |
atgagaattcaaaccaattaagagtttttgtttcttttgtttgcgttcatcttcatcatcgttgttgttggaatatggatcgttgattaaattggg |
54086267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 272 - 311
Target Start/End: Original strand, 54086304 - 54086343
Alignment:
| Q |
272 |
aagatccaacagagatggacgacccttcttcttcctcttt |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54086304 |
aagatccaacagagatggacgacccttcttcttcctcttt |
54086343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University