View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4955-Insertion-6 (Length: 178)
Name: NF4955-Insertion-6
Description: NF4955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4955-Insertion-6 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 8 - 178
Target Start/End: Complemental strand, 117643 - 117468
Alignment:
| Q |
8 |
gttataagactcctgactattctacctttacccaggaagatggaaaatcaaccatggagctcattggaaaatgtacaacgtaatgtagcaagggaaa--- |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| | | | | | |
|
|
| T |
117643 |
gttataagactcctgactattctacctttacccgggaagatggaaaatcaaccatggagctcattggaaaatgtacaacgtaatattacgttgtacattt |
117544 |
T |
 |
| Q |
105 |
-cca-aaacgaattccacaaacttcacttgttccctttatcgttgacatgaacatcatttacgtgatattcctgta |
178 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
117543 |
tccacaaacgaattccacaaacttcacttgttccctttatcgttgacatgaacatcatttacgtgatattcctgta |
117468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University