View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4955-Insertion-8 (Length: 244)
Name: NF4955-Insertion-8
Description: NF4955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4955-Insertion-8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 45; Significance: 9e-17; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 137 - 181
Target Start/End: Original strand, 9833587 - 9833631
Alignment:
| Q |
137 |
gcttcaatcaccttcactctctcttcctctgttatccccgctata |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9833587 |
gcttcaatcaccttcactctctcttcctctgttatccccgctata |
9833631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 8 - 49
Target Start/End: Original strand, 9833458 - 9833499
Alignment:
| Q |
8 |
ataagatgagagaattcaacatcaacaataacattctgccct |
49 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9833458 |
ataagatgagagaattcaacatcaacaacaacattctgccct |
9833499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 137 - 178
Target Start/End: Complemental strand, 51681989 - 51681948
Alignment:
| Q |
137 |
gcttcaatcaccttcactctctcttcctctgttatccccgct |
178 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
51681989 |
gcttcaatcaccttcactctctcttcctccgttatccccgct |
51681948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 140 - 176
Target Start/End: Original strand, 47728470 - 47728506
Alignment:
| Q |
140 |
tcaatcaccttcactctctcttcctctgttatccccg |
176 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
47728470 |
tcaatcaccttcactctctcttcctccgttattcccg |
47728506 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University