View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4955_high_10 (Length: 215)
Name: NF4955_high_10
Description: NF4955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4955_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 15 - 201
Target Start/End: Original strand, 36541869 - 36542055
Alignment:
| Q |
15 |
cagagatcaaccaccttgatagaaaataaatatcacatgaattacatttttcacctttttgtagaccacattggactttggtgtcttcataaaagttata |
114 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |
|
|
| T |
36541869 |
cagagatcaaccaccttgataggaaataaatatcacatgaattacatttttcacctttttgtaggccacattggactttggtgtcttcataaaagttcta |
36541968 |
T |
 |
| Q |
115 |
gatatggatgttatctttcatgttccactgttccttatccattttatgacctggaactccatatatgattaaaacaccgcacaaact |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36541969 |
gatatggatgttatctttcatgttccactgttccttatccattttgtgacctggaactccatatatgattaaaataccgcacaaact |
36542055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 94 - 131
Target Start/End: Complemental strand, 31343748 - 31343711
Alignment:
| Q |
94 |
ggtgtcttcataaaagttatagatatggatgttatctt |
131 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
31343748 |
ggtgtcttcatgaaagttatagatatggatgttatctt |
31343711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 91 - 132
Target Start/End: Original strand, 15871350 - 15871391
Alignment:
| Q |
91 |
tttggtgtcttcataaaagttatagatatggatgttatcttt |
132 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||||| |||| |
|
|
| T |
15871350 |
tttggtgtcttcataaaagttgtagatatgcatgttagcttt |
15871391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 95 - 140
Target Start/End: Original strand, 16999692 - 16999737
Alignment:
| Q |
95 |
gtgtcttcataaaagttatagatatggatgttatctttcatgttcc |
140 |
Q |
| |
|
|||||||||| |||||| |||||||| |||||||||||||| |||| |
|
|
| T |
16999692 |
gtgtcttcatgaaagttgtagatatgaatgttatctttcattttcc |
16999737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University