View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4955_low_8 (Length: 246)

Name: NF4955_low_8
Description: NF4955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4955_low_8
NF4955_low_8
[»] scaffold0132 (2 HSPs)
scaffold0132 (19-234)||(2157-2372)
scaffold0132 (19-234)||(10117-10332)


Alignment Details
Target: scaffold0132 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: scaffold0132
Description:

Target: scaffold0132; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 19 - 234
Target Start/End: Complemental strand, 2372 - 2157
Alignment:
19 gtgtggtgtttaccggctgttcttgtggtttcatctttggagcggttttttgttacagttttgtgttttcctggatatcagctgttgttcctggcagtga 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2372 gtgtggtgtttaccggctgttcttgtggtttcatctttggagcggttttttgttacagttttgtgttttcctggatatcagctgttgttcctggcagtga 2273  T
119 ttaagttttaggtccccacacaactctccaggagggtcaggagctatttctggcagttttgaagttattttagcactcgtgtggggggcagtatgctttt 218  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| ||||||    
2272 ttaagttttaggtccccacgcaactctccaggagggtcaggagctatttttggcagtgttgaagttattttagcactcgtgtggggggcagtacgctttt 2173  T
219 cgggagatggtgccta 234  Q
    ||||||||||||||||    
2172 cgggagatggtgccta 2157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0132; HSP #2
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 19 - 234
Target Start/End: Complemental strand, 10332 - 10117
Alignment:
19 gtgtggtgtttaccggctgttcttgtggtttcatctttggagcggttttttgttacagttttgtgttttcctggatatcagctgttgttcctggcagtga 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10332 gtgtggtgtttaccggctgttcttgtggtttcatctttggagcggttttttgttacagttttgtgttttcctggatatcagctgttgttcctggcagtga 10233  T
119 ttaagttttaggtccccacacaactctccaggagggtcaggagctatttctggcagttttgaagttattttagcactcgtgtggggggcagtatgctttt 218  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| ||||||    
10232 ttaagttttaggtccccacgcaactctccaggagggtcaggagctatttttggcagtgttgaagttattttagcactcgtgtggggggcagtacgctttt 10133  T
219 cgggagatggtgccta 234  Q
    ||||||||||||||||    
10132 cgggagatggtgccta 10117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University