View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4956-Insertion-7 (Length: 337)
Name: NF4956-Insertion-7
Description: NF4956
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4956-Insertion-7 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 108 - 337
Target Start/End: Complemental strand, 50407559 - 50407342
Alignment:
| Q |
108 |
tatctcatgtcaataaaggttggttcaattgcgtaagtactcaattgattannnnnnnnnnnagatactctacaattgcacaagttatccatataaagtt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
50407559 |
tatctcatgtcaataaaggttggttcaattgcgtaagtactcaattgatt---------tatagatactctacaattgcactagttatcgatataaagtt |
50407469 |
T |
|
| Q |
208 |
ctcgtaattttattttttgagaatacttttaaatatatctataataagtgtttctctaaaccttagcacnnnnnnnnnnnnnagaaataaacctttactt |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
50407468 |
ctcgtaattttattttttgagaatacttttaaatatatctataataagtgtttctctaaaccttagcacttttttttttt---gaaataaacctttactt |
50407372 |
T |
|
| Q |
308 |
aattagttaatttgaaatccttaaataatg |
337 |
Q |
| |
|
| |||||||||||||||||||||||||||| |
|
|
| T |
50407371 |
agttagttaatttgaaatccttaaataatg |
50407342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 8 - 73
Target Start/End: Complemental strand, 50407696 - 50407631
Alignment:
| Q |
8 |
acgtcaattttacttggaaactccatgtcttctcttgtccacccgcttgctattaacgttatctct |
73 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50407696 |
acgtcaattctacttggaaactccatgtcttctcttgtccacccgcttgctattaacgttatctct |
50407631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University